shRNA Adeno-associated Virus Serotype 2, p7SK-(PRRC1-shRNA-Seq1)(CAT#: AAV-SI1180WQ)
This product is a PRRC1-shRNA encoding AAV, which is based on AAV-2 serotype. PRRC1 Belongs to the PRRC1 family. 5 isoforms of the human protein are produced by alternative splicing. The expression of PRRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PRRC1-shRNA-Seq1 |
| Related Target/Protein | PRRC1 |
| Region | CDS |
| TargetSeq | CCCACCACTTGTTACTTCTAT |
| NCBI RefSeq | NM_130809 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Head and neck cancer |
