shRNA Adeno-associated Virus Serotype 2, pU6-(JMJD4-shRNA-Seq1)(CAT#: AAV-SI0114WQ)

Datasheet

This product is a JMJD4-shRNA encoding AAV, which is based on AAV-2 serotype. JMJD proteins are mostly epigenetic regulators that demethylate histones. The expression of JMJD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert JMJD4-shRNA-Seq1
Related Target/Protein JMJD4
Region CDS
TargetSeq CAATGTCTGTGGGAGGAAGAA
NCBI RefSeq NM_023007
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 65094
Uniprot ID Q9H9V9

Related Products

Recombinant adeno-associated virus type 9, pU6-(Human PAWR), Overexpression (CAT#:AAV-GTOH1222WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(Lactb2-shRNA-Seq1) (CAT#:AAV-SI1933WQ) Recombinant adeno-associated virus type 2, pU6-(Human EBLN1), Overexpression (CAT#:AAV-GTOH0649WQ) AAV PHP.eB-K14p (MCS-EGFP-3Flag)-SV40 PolyA (CAT#:AAV-GTK0558WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(SPEM1-shRNA-Seq1) (CAT#:AAV-SI2187WQ) Recombinant adeno-associated virus type 2, pU6-(Human BMP2), Overexpression (CAT#:AAV-GTOH0442WQ) Recombinant adeno-associated virus type 9, pU6-(Human prox1), Overexpression (CAT#:AAV-GTOH1645WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(RPRM-shRNA-Seq1) (CAT#:AAV-SI0911WQ)