shRNA Adeno-associated Virus Serotype 2, pU6-(LOC80154-shRNA-Seq3)(CAT#: AAV-SI0252WQ)
This product is a LOC80154-shRNA encoding AAV, which is based on AAV-2 serotype. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LOC80154-shRNA-Seq3 |
| Related Target/Protein | LOC80154 |
| Region | 3UTR |
| TargetSeq | GCATGGCCTATGAAGTGTGTT |
| NCBI RefSeq | NM_025084 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Laryngeal cancer |
