shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KIAA0495-shRNA-Seq1)(CAT#: AdV-SI1427WQ)

Datasheet

This product is a KIAA0495-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA0495-shRNA-Seq1
Related Target/Protein KIAA0495
Region CDS
TargetSeq CAAGTAAAGATACCAGCAGTG
NCBI RefSeq NM_207306
Alternative Names PDAM; TP73-AS1
Titer >1*10^10 GC/mL
Related Diseases Oligodendroglial tumors
Target Gene
Gene ID 57212
Uniprot ID A0A024R4G0

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SPAM1-shRNA-Seq1) (CAT#:AdV-SI2356WQ) Recombinant adenovirus, pU6-(Mouse Mapk3 3'UTR), Overexpression (CAT#:AdV-GTOH0770WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(2310044H10Rik-shRNA-Seq3) (CAT#:AdV-SI1949WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(MRPL16-shRNA-Seq1) (CAT#:AdV-SI0215WQ) Recombinant adenovirus, pU6-(Mouse MCL016), Overexpression (CAT#:AdV-GTOH0120WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CCDC67-shRNA-Seq2) (CAT#:AdV-SI0195WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KHDRBS1-shRNA-Seq1) (CAT#:AdV-SI0044WQ) Recombinant adenovirus, pU6-(Mouse Stmn2(SCG10)), Overexpression (CAT#:AdV-GTOH0038WQ)