shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C20orf24-shRNA-Seq1)(CAT#: AdV-SI0756WQ)

Datasheet

This product is a C20orf24-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C20orf24-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C20orf24-shRNA-Seq1
Related Target/Protein C20orf24
Region 3UTR
TargetSeq CCATCAAGTAACAGCTATTAT
NCBI RefSeq NM_018840
Alternative Names RIP5; PNAS-11; RAB5IF
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55969
Uniprot ID Q9BUV8

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(WBP2NL-shRNA-Seq2) (CAT#:AdV-SI1906WQ) Recombinant adenovirus, pU6-(Human sox4 3'UTR), Overexpression (CAT#:AdV-GTOH0579WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SPACA7-shRNA-Seq1) (CAT#:AdV-SI0595WQ) Recombinant adenovirus, pU6-(Rattus LGI1), Overexpression (CAT#:AdV-GTOH0064WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Csrnp1-shRNA-Seq3) (CAT#:AdV-SI2616WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Rufy2-shRNA-Seq2) (CAT#:AdV-SI1944WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CA3-shRNA-Seq2) (CAT#:AdV-SI0258WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Poc5-shRNA-Seq5) (CAT#:AdV-SI3593WQ)