shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C20orf24-shRNA-Seq1)(CAT#: AdV-SI0255WQ)

This product is a C20orf24-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C20orf24-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C20orf24-shRNA-Seq1
Related Target/Protein C20orf24
Region 3UTR
TargetSeq CCATCAAGTAACAGCTATTAT
NCBI RefSeq NM_018840
Alternative Names RIP5; PNAS-11; RAB5IF
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55969
Uniprot ID Q9BUV8

Related Products