shRNA Lentivirus (self-inactivating), p7SK-(LAMP3-shRNA-Seq2)(CAT#: LV-SI1242WQ)
This product is a LAMP3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LAMP3 regulates hepatic lipid metabolism through activating PI3K/Akt pathway. LAMP3 promotes the invasion of osteosarcoma cells via SPP1 signaling. LAMP3 expression correlated with poor clinical outcome in human ovarian cancer. The expression of LAMP3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LAMP3-shRNA-Seq2 |
| Related Target/Protein | LAMP3 |
| Region | CDS |
| TargetSeq | GTCTCAGATCCAGAGACAATT |
| NCBI RefSeq | NM_014398 |
| Alternative Names | LAMP; CD208; DCLAMP; LAMP-3; TSC403; DC LAMP; DC-LAMP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oral squamous cell carcinoma |