shRNA Lentivirus (self-inactivating), p7SK-(Lrrtm3-shRNA-Seq1)(CAT#: LV-SI4031WQ)
This product is a Lrrtm3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lrrtm3 gene may play a role in the development and maintenance of the vertebrate nervous system. The expression of Lrrtm3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Lrrtm3-shRNA-Seq1 |
| Related Target/Protein | Lrrtm3 |
| Region | CDS |
| TargetSeq | CTCTCCCATAAGTCCTTTGAA |
| NCBI RefSeq | NM_178678 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Vertebrate nervous system disease |
