shRNA Lentivirus (self-inactivating), pH1-(C3orf37-shRNA-Seq2)(CAT#: LV-SI0907WQ)
This product is a C3orf37-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C3orf37 gene acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA. The expression of C3orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C3orf37-shRNA-Seq2 |
| Related Target/Protein | C3orf37 |
| Region | CDS |
| TargetSeq | GAGGCAGTTTCTAAATGGCTT |
| NCBI RefSeq | NM_020187 |
| Alternative Names | DC12; SRAPD1; HMCES |
| Titer | >1*10^10 GC/mL |
| Related Diseases | DNA demethylation |