shRNA Lentivirus (self-inactivating), pH1-(LRRC18-shRNA-Seq2)(CAT#: LV-SI0708WQ)
This product is a LRRC18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LRRC18-shRNA-Seq2 |
| Related Target/Protein | LRRC18 |
| Region | CDS |
| TargetSeq | CCAATCTGATCTCACCCAATT |
| NCBI RefSeq | NM_001006939 |
| Alternative Names | UNQ933; UNQ9338; VKGE9338 |
| Titer | >1*10^10 GC/mL |