shRNA Lentivirus (self-inactivating), pH1-(OR4K5-shRNA-Seq3)(CAT#: LV-SI2554WQ)

This product is a OR4K5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR4K5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4K5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR4K5-shRNA-Seq3
Related Target/Protein OR4K5
Region CDS
TargetSeq GTGCACACATTAAGCCAGTTA
NCBI RefSeq NM_001005483
Alternative Names OR14-16
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 79317
Uniprot ID Q8NGD3

Related Products