shRNA Lentivirus (self-inactivating), pH1-(Ptrh2-shRNA-Seq1)(CAT#: LV-SI3077WQ)
This product is a Ptrh2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Ptrh2 gene is a mitochondrial protein with two putative domains and possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. The expression of Ptrh2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Ptrh2-shRNA-Seq1 |
| Related Target/Protein | Ptrh2 |
| Region | CDS |
| TargetSeq | CCAGATGAAGACACCCTCATT |
| NCBI RefSeq | NM_175004 |
| Alternative Names | PTH; BIT1; PTH2; PTH 2; CFAP37; IMNEPD; CGI-147 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Pancreatic disease (INMEPD) |
