shRNA Lentivirus (self-inactivating), pU6-(PIGW-shRNA-Seq3)(CAT#: LV-SI0141WQ)
This product is a PIGW-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PIGW gene is an inositol acyltransferase that acylates the inositol ring of phosphatidylinositol. Defects in this gene are a cause of the age-dependent epileptic encephalopathy West syndrome as well as a syndrome exhibiting hyperphosphatasia and cognitive disability (HPMRS5). The expression of PIGW-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PIGW-shRNA-Seq3 |
| Related Target/Protein | PIGW |
| Region | CDS |
| TargetSeq | CGTGTAATTACCAGTGCGTTT |
| NCBI RefSeq | NM_178517 |
| Alternative Names | Gwt1; HPMRS5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hyperphosphatasia and mental retardation syndrome |
