shRNA Adeno-associated Virus Serotype 2, pH1-(KIAA0495-shRNA-Seq1)(CAT#: AAV-SI0926WQ)
This product is a KIAA0495-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | KIAA0495-shRNA-Seq1 |
| Related Target/Protein | KIAA0495 |
| Region | CDS |
| TargetSeq | CAAGTAAAGATACCAGCAGTG |
| NCBI RefSeq | NM_207306 |
| Alternative Names | PDAM; TP73-AS1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oligodendroglial tumors |
| Target Gene | |
|---|---|
| Gene ID | 57212 |
| Uniprot ID | A0A024R4G0 |