shRNA Adeno-associated Virus Serotype 2, pU6-(Hsph1-shRNA-Seq4)(CAT#: AAV-SI1968WQ)
This product is a Hsph1-shRNA encoding AAV, which is based on AAV-2 serotype. The Hsph1 gene encodes a member of the heat shock protein 70 family of proteins and functions as a nucleotide exchange factor for the molecular chaperone heat shock cognate 71 kDa protein (Hsc70). The expression of Hsph1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Hsph1-shRNA-Seq4 |
| Related Target/Protein | Hsph1 |
| Region | CDS |
| TargetSeq | GAGATTTCATGGCAGAGCATT |
| NCBI RefSeq | NM_013559 |
| Alternative Names | HSP105; HSP105A; HSP105B; NY-CO-25 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |