shRNA Adeno-associated Virus Serotype 2, pU6-(Fads6-shRNA-Seq1)(CAT#: AAV-SI2318WQ)
This product is a Fads6-shRNA encoding AAV, which is based on AAV-2 serotype. This protein encoded by Fads6 gene is involved in the pathway fatty acid metabolism, which is part of Lipid metabolism.The expression of Fads6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Fads6-shRNA-Seq1 |
Related Target/Protein | Fads6 |
Region | CDS |
TargetSeq | CATGAATGTGTCAGGCTTCAA |
NCBI RefSeq | NM_178035 |
Alternative Names | FP18279 |
Titer | >1*10^10 GC/mL |