shRNA Adeno-associated Virus Serotype 2, pU6-(Fads6-shRNA-Seq1)(CAT#: AAV-SI2318WQ)

This product is a Fads6-shRNA encoding AAV, which is based on AAV-2 serotype. This protein encoded by Fads6 gene is involved in the pathway fatty acid metabolism, which is part of Lipid metabolism.The expression of Fads6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Fads6-shRNA-Seq1
Related Target/Protein Fads6
Region CDS
TargetSeq CATGAATGTGTCAGGCTTCAA
NCBI RefSeq NM_178035
Alternative Names FP18279
Titer >1*10^10 GC/mL
Target Gene
Gene ID 283985
Uniprot ID Q8N9I5

Related Products