shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TTC1-shRNA-Seq1)(CAT#: AdV-SI0645WQ)
This product is a TTC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TTC1 gene encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. The expression of TTC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | TTC1-shRNA-Seq1 |
| Related Target/Protein | TTC1 |
| Region | CDS |
| TargetSeq | CGGCTCGTACTCCATCAATTT |
| NCBI RefSeq | NM_003314 |
| Alternative Names | TPR1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Medullary Thyroid Cancer |