shRNA Lentivirus (self-inactivating), p7SK-(TTC1-shRNA-Seq3)(CAT#: LV-SI1148WQ)
This product is a TTC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TTC1 gene encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. The expression of TTC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TTC1-shRNA-Seq3 |
| Related Target/Protein | TTC1 |
| Region | CDS |
| TargetSeq | GAACTTGGTTCTCCGACCTTT |
| NCBI RefSeq | NM_003314 |
| Alternative Names | TPR1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Medullary Thyroid Cancer |
