shRNA Adeno-associated Virus Serotype 2, p7SK-(AARSD1-shRNA-Seq1)(CAT#: AAV-SI1345WQ)

Datasheet

This product is a AARSD1-shRNA encoding AAV, which is based on AAV-2 serotype. The AARSD1 gene functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). The expression of AARSD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert AARSD1-shRNA-Seq1
Related Target/Protein AARSD1
Region CDS
TargetSeq GCAGTTGCTGACCATCTATTT
NCBI RefSeq NM_025267
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 80755
Uniprot ID Q9BTE6

Related Products

shRNA Adeno-associated Virus Serotype 2, pH1-(Olfr1163-shRNA-Seq1) (CAT#:AAV-SI2865WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(OR13F1-shRNA-Seq1) (CAT#:AAV-SI2489WQ) Recombinant adeno-associated virus type 9, pU6-(Saccharomyces cerevisiae CD), Overexpression (CAT#:AAV-GTOH1116WQ) Recombinant adeno-associated virus type 2, pU6-(Human IL2), Overexpression (CAT#:AAV-GTOH0198WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(Bcdin3d-shRNA-Seq1) (CAT#:AAV-SI3100WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(OR8I2-shRNA-Seq2) (CAT#:AAV-SI1697WQ) Recombinant adeno-associated virus type 9, pU6-(Human FOXK1 3'UTR), Overexpression (CAT#:AAV-GTOH1648WQ) shRNA Adeno-associated Virus Serotype 2, p7SK-(SAMD13-shRNA-Seq1) (CAT#:AAV-SI1451WQ)