shRNA Adeno-associated Virus Serotype 2, p7SK-(C20orf43-shRNA-Seq2B)(CAT#: AAV-SI3702WQ)
This product is a C20orf43-shRNA encoding AAV, which is based on AAV-2 serotype. The C20orf43 gene may be required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication and function to facilitate fork pausing at replication fork barriers like the rDNA. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C20orf43-shRNA-Seq2B |
Related Target/Protein | C20orf43 |
Region | CDS |
TargetSeq | GATGATGTCATCGTGCTCAAT |
NCBI RefSeq | NM_016407 |
Alternative Names | CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3 |
Titer | >1*10^10 GC/mL |