shRNA Adeno-associated Virus Serotype 2, p7SK-(C6orf141-shRNA-Seq3)(CAT#: AAV-SI1312WQ)
This product is a C6orf141-shRNA encoding AAV, which is based on AAV-2 serotype. Low C6orf141 Expression is Significantly Associated with a Poor Prognosis in Patients with Oral Cancer. The expression of C6orf141-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C6orf141-shRNA-Seq3 |
Related Target/Protein | C6orf141 |
Region | CDS |
TargetSeq | GAAAGTGCTCTTTCTCCTGCA |
NCBI RefSeq | NM_153344 |
Titer | >1*10^10 GC/mL |
Related Diseases | Oral Cancer |