shRNA Adeno-associated Virus Serotype 2, p7SK-(CCDC84-shRNA-Seq1)(CAT#: AAV-SI4040WQ)
This product is a CCDC84-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC84 gene encodes a protein thought to contain a coiled coil motif. The expression of CCDC84-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CCDC84-shRNA-Seq1 |
| Related Target/Protein | CCDC84 |
| Region | CDS |
| TargetSeq | GCACAAGAAAGCAACCAACAA |
| NCBI RefSeq | NM_198489 |
| Alternative Names | DLNB14 |
| Titer | >1*10^10 GC/mL |