shRNA Adeno-associated Virus Serotype 2, p7SK-(Defb41-shRNA-Seq1)(CAT#: AAV-SI3908WQ)
This product is a Defb41-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by OR8D4 gene has bactericidal activity and may play a role in the antimicrobial protection of sperm and urogenital tract epithelia. The expression of Defb41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Defb41-shRNA-Seq1 |
| Related Target/Protein | Defb41 |
| Region | CDS |
| TargetSeq | CTGTATCAGATGGAGGAACCA |
| NCBI RefSeq | NM_183124 |
| Alternative Names | BD-17; Bd-41; Defb16; Defb17; Gm15386; 9230102D03Rik |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Antimicrobial protection |