shRNA Adeno-associated Virus Serotype 2, p7SK-(Fchsd1-shRNA-Seq5)(CAT#: AAV-SI3587WQ)
This product is a Fchsd1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Fchsd1 gene may promotes actin polymerization mediated by SNX9 and WASL. The expression of Fchsd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Fchsd1-shRNA-Seq5 |
Related Target/Protein | Fchsd1 |
Region | 3UTR |
TargetSeq | GCGGATTTATTGACAGTGAAT |
NCBI RefSeq | NM_175684 |
Alternative Names | NWK2 |
Titer | >1*10^10 GC/mL |