shRNA Adeno-associated Virus Serotype 2, p7SK-(Lactb2-shRNA-Seq3)(CAT#: AAV-SI3635WQ)

This product is a Lactb2-shRNA encoding AAV, which is based on AAV-2 serotype. The Lactb2 gene is required for normal mitochondrial function and cell viability. The expression of Lactb2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Lactb2-shRNA-Seq3
Related Target/Protein Lactb2
Region CDS
TargetSeq CCGAGAAGAACAGATTATTTC
NCBI RefSeq NM_145381
Alternative Names CGI-83
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51110
Uniprot ID Q53H82

Related Products