shRNA Adeno-associated Virus Serotype 2, p7SK-(LGI4-shRNA-Seq3)(CAT#: AAV-SI1095WQ)
This product is a LGI4-shRNA encoding AAV, which is based on AAV-2 serotype. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LGI4-shRNA-Seq3 |
| Related Target/Protein | LGI4 |
| Region | CDS |
| TargetSeq | CCCAAGACTTTCAAGTGCAGA |
| NCBI RefSeq | NM_139284 |
| Alternative Names | LGIL3; AMCNMY |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurological diseases |