shRNA Adeno-associated Virus Serotype 2, p7SK-(LIMS2-shRNA-Seq2)(CAT#: AAV-SI1152WQ)

This product is a LIMS2-shRNA encoding AAV, which is based on AAV-2 serotype. LIMS2 gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The expression of LIMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LIMS2-shRNA-Seq2
Related Target/Protein LIMS2
Region 3UTR
TargetSeq CCTCCCTTTCTCTTTCCTCAT
NCBI RefSeq NM_017980
Alternative Names LGMD2W; PINCH2; MDRCMTT; PINCH-2
Titer >1*10^10 GC/mL
Related Diseases Muscular dystrophy, severe cardiomyopathy and triangular tongues
Target Gene
Gene ID 55679
Uniprot ID Q7Z4I7

Related Products