shRNA Adeno-associated Virus Serotype 2, p7SK-(Med18-shRNA-Seq3)(CAT#: AAV-SI3580WQ)
This product is a Med18-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Med18-shRNA-Seq3 |
Related Target/Protein | Med18 |
Region | CDS |
TargetSeq | CTCTGATGACATGAGGAACTT |
NCBI RefSeq | NM_026039 |
Alternative Names | SRB5; p28b |
Titer | >1*10^10 GC/mL |