shRNA Adeno-associated Virus Serotype 2, p7SK-(MORC2-shRNA-Seq1)(CAT#: AAV-SI1377WQ)
This product is a MORC2-shRNA encoding AAV, which is based on AAV-2 serotype. The MORC2 gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The expression of MORC2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | MORC2-shRNA-Seq1 |
| Related Target/Protein | MORC2 |
| Region | CDS |
| TargetSeq | CATCTATAAGTACTCTCCATT |
| NCBI RefSeq | NM_014941 |
| Alternative Names | ZCW3; CMT2Z; ZCWCC1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |