shRNA Adeno-associated Virus Serotype 2, p7SK-(Phf14-shRNA-Seq1)(CAT#: AAV-SI3934WQ)

This product is a Phf14-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Phf14 gene has metal ion binding ability. The expression of Phf14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Phf14-shRNA-Seq1
Related Target/Protein Phf14
Region 3UTR
TargetSeq CTCCTCAAGCTTCAAAGACTT
NCBI RefSeq NM_029404
Titer >1*10^10 GC/mL
Target Gene
Gene ID 9678
Uniprot ID O94880

Related Products