shRNA Adeno-associated Virus Serotype 2, p7SK-(Psme4-shRNA-Seq3)(CAT#: AAV-SI3423WQ)
This product is a Psme4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Psme4 gene is associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during spermatogenesis and DNA damage response. The expression of Psme4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Psme4-shRNA-Seq3 |
Related Target/Protein | Psme4 |
Region | CDS |
TargetSeq | GCAAAGAAATCTGCCTTGGAA |
NCBI RefSeq | NM_134013 |
Alternative Names | PA200 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |