shRNA Adeno-associated Virus Serotype 2, p7SK-(Rsrc2-shRNA-Seq1)(CAT#: AAV-SI3974WQ)

This product is a Rsrc2-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Rsrc2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Rsrc2-shRNA-Seq1
Related Target/Protein Rsrc2
Region CDS
TargetSeq GCGATTAAATTCATCTGAGAA
NCBI RefSeq NM_001005523
Titer >1*10^10 GC/mL
Target Gene
Gene ID 65117
Uniprot ID Q7L4I2

Related Products