shRNA Adeno-associated Virus Serotype 2, p7SK-(Scap-shRNA-Seq1)(CAT#: AAV-SI3981WQ)

This product is a Scap-shRNA encoding AAV, which is based on AAV-2 serotype. The Scap gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The expression of Scap-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Scap-shRNA-Seq1
Related Target/Protein Scap
Region CDS
TargetSeq CATCCTGTTTGCCTACATCTA
NCBI RefSeq NM_001001144
Titer >1*10^10 GC/mL
Target Gene
Gene ID 22937
Uniprot ID Q12770

Related Products