shRNA Adeno-associated Virus Serotype 2, p7SK-(SF3A2-shRNA-Seq2)(CAT#: AAV-SI1062WQ)

This product is a SF3A2-shRNA encoding AAV, which is based on AAV-2 serotype. The SF3A2 gene encodes subunit 2 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SF3A2-shRNA-Seq2
Related Target/Protein SF3A2
Region CDS
TargetSeq CTACGAGACCATTGCCTTCAA
NCBI RefSeq NM_007165
Alternative Names PRP11; SAP62; PRPF11; SF3a66
Titer >1*10^10 GC/mL
Related Diseases Mitotic chromosome segregation
Target Gene
Gene ID 8175
Uniprot ID Q15428

Related Products