shRNA Adeno-associated Virus Serotype 2, p7SK-(SF3A3-shRNA-Seq5)(CAT#: AAV-SI1060WQ)
This product is a SF3A3-shRNA encoding AAV, which is based on AAV-2 serotype. The SF3A3 gene encodes subunit 3 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SF3A3-shRNA-Seq5 |
| Related Target/Protein | SF3A3 |
| Region | CDS |
| TargetSeq | GACTCAAGCAAATAAAGGAAT |
| NCBI RefSeq | NM_006802 |
| Alternative Names | PRP9; PRPF9; SAP61; SF3a60 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer |