shRNA Adeno-associated Virus Serotype 2, p7SK-(TSR2-shRNA-Seq2)(CAT#: AAV-SI1284WQ)

This product is a TSR2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by TSR2 gene appears to repress the transcription of NF-kappaB and may be involved in apoptosis. Defects in this gene are a cause of Diamond-Blackfan anemia. The expression of TSR2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TSR2-shRNA-Seq2
Related Target/Protein TSR2
Region CDS
TargetSeq GATTACTTCATGCGCAATGCT
NCBI RefSeq NM_058163
Alternative Names WGG1; DBA14; DT1P1A10
Titer >1*10^10 GC/mL
Related Diseases Diamond-Blackfan anemia
Target Gene
Gene ID 90121
Uniprot ID Q969E8

Related Products