shRNA Adeno-associated Virus Serotype 2, p7SK-(Vipar-shRNA-Seq1)(CAT#: AAV-SI4032WQ)
This product is a Vipar-shRNA encoding AAV, which is based on AAV-2 serotype. The Vipar gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). The expression of Vipar-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Vipar-shRNA-Seq1 |
Related Target/Protein | Vipar |
Region | 3UTR |
TargetSeq | CCAGCCTTTGAGCACATGTAT |
NCBI RefSeq | NM_134044 |
Alternative Names | SPE39; VIPAR; SPE-39; VPS16B; hSPE-39; C14orf133; VIPAS39 |
Titer | >1*10^10 GC/mL |
Related Diseases | Arthrogryposis, renal dysfunction, and cholestasis-2 |