shRNA Adeno-associated Virus Serotype 2, p7SK-(Vipar-shRNA-Seq1)(CAT#: AAV-SI4032WQ)
This product is a Vipar-shRNA encoding AAV, which is based on AAV-2 serotype. The Vipar gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). The expression of Vipar-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Vipar-shRNA-Seq1 |
| Related Target/Protein | Vipar |
| Region | 3UTR |
| TargetSeq | CCAGCCTTTGAGCACATGTAT |
| NCBI RefSeq | NM_134044 |
| Alternative Names | SPE39; VIPAR; SPE-39; VPS16B; hSPE-39; C14orf133; VIPAS39 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Arthrogryposis, renal dysfunction, and cholestasis-2 |
