shRNA Adeno-associated Virus Serotype 2, p7SK-(WDR46-shRNA-Seq1)(CAT#: AAV-SI1495WQ)
This product is a WDR46-shRNA encoding AAV, which is based on AAV-2 serotype. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | WDR46-shRNA-Seq1 |
| Related Target/Protein | WDR46 |
| Region | CDS |
| TargetSeq | GAAGTTCTGTCGCATTGACAA |
| NCBI RefSeq | NM_005452 |
| Alternative Names | UTP7; BING4; FP221; C6orf11 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Respiratory Disease |