shRNA Adeno-associated Virus Serotype 2, pH1-(1700065I17Rik-shRNA-Seq2)(CAT#: AAV-SI2662WQ)
This product is a 1700065I17Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 1700065I17Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | 1700065I17Rik-shRNA-Seq2 |
| Related Target/Protein | 1700065I17Rik |
| Region | CDS |
| TargetSeq | GAGATAAAGATTACCGACATG |
| NCBI RefSeq | NM_026099 |
| Alternative Names | Tex43, Tseg7 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Testis disease |
