shRNA Adeno-associated Virus Serotype 2, pH1-(6430548M08Rik-shRNA-Seq1)(CAT#: AAV-SI3169WQ)

This product is a 6430548M08Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 6430548M08Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 6430548M08Rik-shRNA-Seq1
Related Target/Protein 6430548M08Rik
Region CDS
TargetSeq CAATGAGTCCTTCTCCTCCAA
NCBI RefSeq NM_172286
Alternative Names AW049007; Kiaa0513; mKIAA0513
Titer >1*10^10 GC/mL
Target Gene
Gene ID 234797
Uniprot ID D3YUS2

Related Products