shRNA Adeno-associated Virus Serotype 2, pH1-(Ammecr1-shRNA-Seq1)(CAT#: AAV-SI3151WQ)
This product is a Ammecr1-shRNA encoding AAV, which is based on AAV-2 serotype. Submicroscopic deletion of the Ammecr1 may result in a contiguous gene deletion syndrome, the AMME complex. The expression of Ammecr1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Ammecr1-shRNA-Seq1 |
| Related Target/Protein | Ammecr1 |
| Region | 3UTR |
| TargetSeq | GCCTCATGTTATAGAACAATT |
| NCBI RefSeq | NM_019496 |
| Alternative Names | MFHIEN; AMMERC1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis |
