shRNA Adeno-associated Virus Serotype 2, pH1-(C10orf27-shRNA-Seq2)(CAT#: AAV-SI0981WQ)
This product is a C10orf27-shRNA encoding AAV, which is based on AAV-2 serotype. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C10orf27-shRNA-Seq2 |
| Related Target/Protein | C10orf27 |
| Region | CDS |
| TargetSeq | CACAGAGAAGAAGACATCGAA |
| NCBI RefSeq | NM_152710 |
| Alternative Names | SPATIAL; TBATA |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Multiple sclerosis (MS) |