shRNA Adeno-associated Virus Serotype 2, pH1-(CAMSAP1-shRNA-Seq2)(CAT#: AAV-SI0804WQ)
This product is a CAMSAP1-shRNA encoding AAV, which is based on AAV-2 serotype. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CAMSAP1-shRNA-Seq2 |
| Related Target/Protein | CAMSAP1 |
| Region | CDS |
| TargetSeq | GAAGAGGAGCTTGTGGCTATT |
| NCBI RefSeq | NM_015447 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular Carcinoma |