shRNA Adeno-associated Virus Serotype 2, pH1-(CCDC116-shRNA-Seq3)(CAT#: AAV-SI0609WQ)

This product is a CCDC116-shRNA encoding AAV, which is based on AAV-2 serotype. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CCDC116-shRNA-Seq3
Related Target/Protein CCDC116
Region CDS
TargetSeq GATGAGGACAAGGATGAGGAT
NCBI RefSeq NM_152612
Titer >1*10^10 GC/mL
Related Diseases colorectal cancer, breast cancer, esophageal cancer, gastric cancer
Target Gene
Gene ID 164592
Uniprot ID Q8IYX3

Related Products