shRNA Adeno-associated Virus Serotype 2, pH1-(CREG2-shRNA-Seq2)(CAT#: AAV-SI0735WQ)
This product is a CREG2-shRNA encoding AAV, which is based on AAV-2 serotype. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CREG2-shRNA-Seq2 |
| Related Target/Protein | CREG2 |
| Region | CDS |
| TargetSeq | CCTCGCTGATGCTGCCAGAAT |
| NCBI RefSeq | NM_153836 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Brain disease |
