shRNA Adeno-associated Virus Serotype 2, pH1-(Cyb5d2-shRNA-Seq4)(CAT#: AAV-SI2889WQ)

This product is a Cyb5d2-shRNA encoding AAV, which is based on AAV-2 serotype. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Cyb5d2-shRNA-Seq4
Related Target/Protein Cyb5d2
Region CDS
TargetSeq CGCAGAAAGCAATACTTGGTA
NCBI RefSeq XM_109819
Alternative Names CYB5D2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 124936
Uniprot ID Q8WUJ1

Related Products