shRNA Adeno-associated Virus Serotype 2, pH1-(DZIP1L-shRNA-Seq2)(CAT#: AAV-SI0637WQ)

This product is a DZIP1L-shRNA encoding AAV, which is based on AAV-2 serotype. The DZIP1L gene encoded proterin is involved in primary cilium formation. Probably acts as a transition zone protein required for localization of PKD1/PC1 and PKD2/PC2 to the ciliary membrane. The expression of DZIP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DZIP1L-shRNA-Seq2
Related Target/Protein DZIP1L
Region CDS
TargetSeq CCAGTGGAAGAGGTGTTAGAA
NCBI RefSeq NM_173543
Alternative Names PKD5; DZIP2
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 199221
Uniprot ID Q8IYY4

Related Products