shRNA Adeno-associated Virus Serotype 2, pH1-(Eif4h-shRNA-Seq4)(CAT#: AAV-SI2781WQ)
This product is a Eif4h-shRNA encoding AAV, which is based on AAV-2 serotype. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Eif4h-shRNA-Seq4 |
| Related Target/Protein | Eif4h |
| Region | CDS |
| TargetSeq | GACTTCAGAGAACCCACAGAA |
| NCBI RefSeq | NM_033561 |
| Alternative Names | WSCR1; WBSCR1; eIF-4H |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Williams syndrome |