shRNA Adeno-associated Virus Serotype 2, pH1-(Gvin1-shRNA-Seq1)(CAT#: AAV-SI2603WQ)
This product is a Gvin1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Gvin1-shRNA-Seq1 |
| Related Target/Protein | Gvin1 |
| Region | 3UTR |
| TargetSeq | GAGGATCTGCAGTAGACATTT |
| NCBI RefSeq | NM_029000 |
| Alternative Names | GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1 |
| Titer | >1*10^10 GC/mL |