shRNA Adeno-associated Virus Serotype 2, pH1-(Hemgn-shRNA-Seq1)(CAT#: AAV-SI3128WQ)
This product is a Hemgn-shRNA encoding AAV, which is based on AAV-2 serotype. The Hemgn gene may regulate the proliferation and differentiation of hematopoietic cells. The expression of Hemgn-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Hemgn-shRNA-Seq1 |
| Related Target/Protein | Hemgn |
| Region | CDS |
| TargetSeq | CAAGAAGCAGTTGAACCTGAA |
| NCBI RefSeq | NM_053149 |
| Alternative Names | NDR; EDAG; CT155; EDAG-1 |
| Titer | >1*10^10 GC/mL |
