shRNA Adeno-associated Virus Serotype 2, pH1-(Hemgn-shRNA-Seq1)(CAT#: AAV-SI3128WQ)
This product is a Hemgn-shRNA encoding AAV, which is based on AAV-2 serotype. The Hemgn gene may regulate the proliferation and differentiation of hematopoietic cells. The expression of Hemgn-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Hemgn-shRNA-Seq1 |
Related Target/Protein | Hemgn |
Region | CDS |
TargetSeq | CAAGAAGCAGTTGAACCTGAA |
NCBI RefSeq | NM_053149 |
Alternative Names | NDR; EDAG; CT155; EDAG-1 |
Titer | >1*10^10 GC/mL |